Haplogroup G2c (Y-DNA)

Haplogroup G2c
Possible time of origin ~1,000 CE
Possible place of origin Northeastern West Asia
Ancestor G
Defining mutations M377, L72
Highest frequencies Ashkenazi Jews, Pashtuns

In human genetics, Haplogroup G2c (formerly G5) is a Y-chromosome haplogroup and is defined by the presence of the M377 mutation.[1] It is a branch of Haplogroup G, which in turn is defined by the presence of the M201 mutation.[2]

G2c is a major Y chromosome haplogroup, and yet unique: It has a very high frequency in Ashkenazi Jews, and shows strong evidence of a very recent settlement in Europe. (See also page covering Jews with Haplogroup G (Y-DNA)). The TMRCA (time until most recent common ancestor) appears to be around 1100 CE for this close group of Ashkenazi Jews. It is rare outside of northern Europe but there is recent evidence that this haplogroup is also found in certain Lebanese Christian populations originating from southern Syria and it has been found in a single Turk from Kars Province in Turkey on the border with Armenia, a Pashtun from the area of Pakistan bordering Afghanistan in the Hindu Kush range, and a single Burusho from the Hunza Valley in the Karakorum Range in Kashmir. Recently, it was discovered that an Egyptian and a Jordanian have values very similar to the Lebanese G2c group. It is confirmed that a sample from Sicily was G2c and the common ancestor between the Jewish group and this lone Sicilian match up to the time Titus brought the Jews out of Judea. This Jewish group could very well be Italkim Jews (Italian Jews); which would explain why it was never found amongst Sephardi Jews (those with origins in Spain or Portugal) and would explain it's rather late arrival into Eastern Europe.

G2c presents more mysteries regarding its origin and distribution than virtually any other major Y haplogroup. Haplogroups that are rare in certain regions are more common in another, and have rather clear origins in other places where they are more commonly found. G2c has none of these obvious characteristics. It is most common by far in a region where it arrived very recently, but rare in other region including its likely area of origin. The distribution of G2c is sparse and dispersed, with almost no G2c haplotypes found in very large intervening regions. This pattern is unique among Y haplogroups.

Contents

Phylogenetic position

Extensive single nucleotide polymorphism (SNP) testing by the Haplogroup G SNP project[3] found that G2c is an independent branch of haplogroup G characterized by only one SNP, M377. A forthcoming study by the Y Chromosome Consortium at the University of Arizona found that within haplogroup G, G2c and G2 share a new SNP, P287, which is not found in the other well-attested branch of G, haplogroup G1. As a result, it will be proposed that Haplogroup G5 be renamed "G2c".

Recent changes to the phylogeny are listed in red.

     G      


G*



     G1 (M285,M342)     


G1*



      (P20)    

G1a



      (P76)    

G1b [new]




     G2 (P287) [new G2]     



G2* [new]



     G2a (P15, L31 = S149) [old G2]     


G2a* [old G2*]



     G2a1 (P16) [old G2a]     


G2a1* [old G2a]



         (P18)       

 G2a1a [old G2a1]




     (M286)     

G2a2 [old G2b]



     G2a3 (L30 = S126, L32 = S148 = U8) [new]     



G2a3* [new]



     G2a3a (M406) [new]     



G2a3a* [new]        





(L14 = S133) G2a3a1 [new]        





     G2a3b (P303) [new]     


G2a3b1 (U1 = S135)  [new]        


     G2a3b1* [new]        





(L13 = S131 = U13) G2a3b1a [new]        






(S147, S148) G2a3b2a [new]        









     (M287)     

G2b [old G3]



     (M377)     

G2c* [old G5]


     (M283) [new]     

G2c1 [new]






Haplogroup G SNP reference table
Ref SNP ID Ethnoancestry Family Tree DNA G SNP Project
rs35160044 G2
rs34134567 S126 L30 U8
rs35474563 S130 L14 U16?
rs9786706 S131 L13 U13
rs9786246 S132
rs35169834 S133
rs34977142 S134 U16?
rs9786316? S135 U1?
rs34334142 S146
rs35251548 S147
rs7892988 S148 L32
rs35617575 S149 L31

Haplogroup characteristics

Distinguishing Y-STR alleles

For the full listing of all the G2c Y-STR modal haplotype values, see the entry:
HRGEN in ySearch.org

All G2c samples tested so far have a null value for the DYS425 marker, (a missing "T" allele of the DYS371 palindromic Y-STR, the result of a RecLOH event. This change is extremely uncommon in the rest of haplogroup G, but apparently happened early in the history of G2c.

G2c Y-STR distinguishing allele values
Y-STR Allele range Modals
DYS393 12-13 13
DYS390 23-24 23
DYS19 15-17 15
17
DYS391 10-12 10
11
DYS385* 13,15
13,16
13,17
14,16
13,16
DYS426 11
DYS388 12
DYS439 11-12 11
DYS392 11
DYS389 13,29
13,30
13,31
14,31
14,32
14,33
15,33
13,30
14,31
14,32
DYS459 8,9
DYS464 13,13,14,15
13,13,15,15
13,14,14,15
13,14,15,15
13,14,15,15
DYS607 15-17 16
DYS395S1a 16,16
DYS425 null
DYS413 21,22
DYS436 11
DYS481 19
DYS461 12

* In haplogroup G2c, according to the Kittler Protocol for DYS385 which tests for the actual order of the DYS385 alleles along the Y chromosome, the smaller allele precedes the larger and therefore the allele sequence given here is physically correct.

Primer sequence

SNP
name
gene gene
location
Y position
M377 DDX3Y intron 10 15,536,827
Primer (5'→3')[1]
position
(bp)
SNP forward reverse length
(bp)
40 A→T tatgcatttgttgagtatatgtc gttctgaatgaaagttcaaacg 326

Distribution

Ashkenazi Jews

A cluster of closely related Ashkenazi Jews represent virtually all confirmed G2c persons worldwide, both from private testing, and from academic studies. Of 211 known European G2cs, 8 are known to have non-Jewish patrilineal ancestors. G2c makes up about 7% of all Ashkenazi Jewish Y chromosome haplotypes, as was found in Behar et al. (2004) (n=442, GxG2=33).[4] In the supplemental data from Behar et al. (2004), among the Ashkenazi Jewish G haplotypes haplotypes 4 and 6-15 are G2c, 2,3,5 are G1, and the haplogroup of the first listed is unclear. A much smaller group of Ashkenazi Jews however are in haplogroup G1, so not all GxG2 Ashkenazi Jews in the above study would be G2c. In a sample of 955 haplogroup G haplotypes, there are 103 Ashkenazi G2cs and 14 Ashkenazi G1s. The ratio of G2c:G1 among Ashkenazi Jews is approximately 10:1.

Eastern Europe

The distribution of G2c in Eastern Europe very closely reflects the 16th and 17th century settlement patterns of Ashkenazi Jews in the Polish-Lithuanian Commonwealth:

Western Germany

G2c is also found among Ashkenazi Jews from Western Germany. Jews were not allowed to reside in most parts of Germany in the 16th and 17th centuries, aside from the Frankfurt Jewish Ghetto. Jews were expelled in 1670 from Vienna and the Archduchy of Austria.[5] After Khmelytsky's Pogrom in Poland in 1648, there began a migration of Jews from Poland and Lithuania to Western Germany, which accelerated and continued into the 19th century. It isn't clear at this point whether German Jewish G2cs represent an independent settlement, or the result of a migration from Eastern Europe (although there is some evidence for the latter).

Southern Italy and Sicily

Among Europeans, there are a few significant exceptions to this almost exclusive Ashkenazi Jewish distribution - out of 211 known European G2cs, there are 4 Sicilians, including 3 members of one family with a tradition of Jewish patrilineal descent from 16th century Sicily.

Southwest Syria

It appears as if there are a few individuals of Syrian descent that also share this haplogroup. However, their split from the rest of the group should be a minimum of 2,000 years with further testing. It appears as if this group will fall into the G2c* group and not the G2c1 group with the Pashtuns. The highlands of the Syria could very well be the origin of haplogroup G as a whole due to the diverse G haplogroups seeming to originate there in ancient times.

Eastern Anatolia

A confirmed G2c Y-STR haplotype[6] found in the literature is haplotype 54 from a study of Anatolian Y chromosomes (n=523) by Cinnioglu et al. (2004) which was found in Eastern Turkey, in the city of Kars, very close to Armenia.[7]

The Hindu Kush and Kashmir (Pakistan)

There are just two other confirmed G2c samples that have been publicly reported in the academic literature so far, one Pashtun in the Khyber Pakhtunkhwa province of Pakistan (the Hindu Kush Range), and one Burusho in the Hunza Valley in Kashmir. These two G2cs are Y-STR haplotypes 731 and 794 from Table 3 in the study by Sengupta et al. (2006) of Indian (n=728), Pakistani (n=176), and East Asian (n=175) Y chromosome lineages.[1] Firasat et al. (2007) found 1 G among 97 Burushos, and in Sengupta et al. (2006) the only Burusho G was G2c, making it likely that this single G is G2c as well.[8] The YHRD European forensic database has several haplotypes from Pakistan that are very likely to be G2c, including 1 Burusho (n=94) and 5 Pashtuns (n-93).[9][10]

Hunza

Hunza was an important stop on the Silk Road from the Near East to China. The fertile Hunza Valley was the last resting point before the Khunjerab Pass (el. 4693 m./15397 ft.) which was the highest point on the southern route of the Silk Road from Iran, the Indian Ocean ports of the Makran Coast in Pakistan, to the Kashgar oasis in the Gobi Desert of western China. Among the Burusho South Asian Y haplogroups predominate, but there are some representatives of Central Asian (C3) and East Asian (O3) haplogroups as well.[1][8] Sengupta et al. (2006) found the Burushos to be completely lacking in haplogroup G2a which is well-represented among the nearby Kalash and Pashtun populations.[8]

Historical background of the Ani region

In 894 CE, the Bagratid Prince Ashot I was given the title of King of Armenia by the Abbasid Caliphate[11] and briefly established his capital at the ancient Armenian center of Bagaran 40 km south of Ani, and then moved it to Shirakavan, 15 km northeast of Ani. In 929 the capital was transferred to Kars, 42 km west of Ani, and then in 969 to Ani itself.[12][13] Ani in the 10th and 11th centuries had a population as high as 100,000 - 200,000. The city continued to flourish even after the capture of Ani in 1064 by the Seljuks under Alp Arslan, and the subsequent rule by the Kurdish Muslim Shaddadid dynasty from 1072-1199. In 1199 Ani was captured by the forces of Queen Tamar of Georgia and a Georgian vassal kingdom was created which was ruled by the Zakarid dynasty. In 1236, the Mongols captured Ani, killing many of its inhabitants, but afterward it was continued to be ruled by the Georgian Zakarids. After its capture by the Turkic Kara Koyunlu in the 1330s, Ani declined rapidly. The Kara Koyunlu moved their capital to Yerevan in 1446 and by the 18th century Ani had been completely abandoned.[14]

There is no evidence that Ani or the adjacent areas ever had a Jewish population in the Medieval period.[15] There may have been an early presence of Jews in the Kingdom of Armenia in late Hellenistic and Roman times before the conversion of Armenia to Christianity,[16] However, the possible presence of G2c almost exclusively in the region of the Medieval capitals of Armenia, Bagaran, Shirakavan, Kars, and Ani would indicate that, if indeed these haplotypes are G2c, it appeared in Armenia no earlier than 802 CE and no later than the mid-14th century.

Other predicted G2c Jewish haplotypes

Two possible G2c Y-STR haplotype samples in the literature are from the study of Jewish and non-Jewish Near Eastern Y chromosomes by Nebel et al. (2001) (in the Appendix Table A1), haplotype 51 which was found in 1 Ashkenazi Jew (n=79) and 3 Kurdish Jews[17] (n=99), and haplotype 47 which was found in 1 Iraqi Jew (combined Iraqi Jews n=20 and Syrian Jews n=3). However, recently advancements in haplogroup prediction have determined these haplotypes G2c. These also belong to what was termed at the time "Haplogroup 2", (F*,G, and I)[18] and within this set of haplogroups these display a Y-STR allele pattern unique to haplogroup G2c. In this study, G2c was found among 3% of Kurdish Jews.[19] However, as with the Armenians, there are some G2 haplotypes that appear similar to G2c at these 6 STRs, but not at DYS389.[20]

Upcoming studies

Other Y chromosome samples taken from an upcoming study of Sephardi and Near Eastern (Mizrahi) Jews have found only a few GxG2 (in Y chromosome haplogroup G but not in G2) samples. Preliminary indications are that in this study, only a single Turkish Jew matches the any of the modal haplotypes for G2c, however, all of these samples are being tested for M377/G2c.

The Kurdish and Iraqi Jewish samples from Nebel et al. (2002) are also being tested for M377/G2c by a different group for another study. Y chromosome haplogroup G1 is also found among Jewish populations, but it is likely that some of these samples will turn out to be in haplogroup G2c.

Comparison of regional haplotypes

Population and
Location
n Status DYS393 DYS390 DYS19 DYS391 DYS385 DYS426 DYS388 DYS439 DYS392 DYS389 DYS438 DYS461
= add 2 to DYSA7.2
Ashkenazi Jews

Poland-Lithuania
Western Germany Sicilians

300 confirmed 12
13
 
22
23
24
 
15
16
9
10
11
13,15
13,16
14,16
11 12  
11
12
11 13,30
13,31
13,32
13,33
14,31
14,32
14,33
15,33
10 12
Turkey
Kars
1 confirmed 13 23 16 10 11 12 11 11 13,29
Pathans 1 confirmed 13 23 16 11 13,16 11 12 11 11 13,30
Pathans 6 confirmed 13 23 17 10 11 12 11 11 13,30 12
Burusho
Hunza Valley
1 confirmed 13 23 17 11 11 12 11 11 13,30 12
Greek
Athens
1 unlikely 13 23 16 11 13,16 11 13,31
Syrians 2 unlikely 13 23 16 11 14,16
14,15
11 13,30
Iranian
Tehran
1 unlikely 13 23 17 10 13,16 11 13,29
Iraqi Jew 1 predicted G2c 13 23 15 11 11 12 11
Armenians
The Ani region
Nagorno-Karabakh
5 predicted G2c 13 23 15 10 11 12 11
Kurdish Jews 3 predicted G2c 13 23 15 10 11 12 11

Time to the Most Recent Common Ancestor (tMRCA)

The time to the Most Recent Common Ancestor (tMRCA) for European G2c, derived by generating a median-joining network[21] of over 25 haplotypes with 67 Y-STRs, yields a date of 955 years from the average birth year of the testees (estimated to be 1950), with a standard deviation of 107 years.[22] The mutation rate used is based on that of family groups with known most recent common ancestors.[23] So far, this tMRCA includes all groups of European G2cs, including it seems from preliminary evidence, the Italians.

This late tMRCA date for all of G2c in Europe raises the question of when G2c first entered Europe. If G2c entered Europe at an earlier period, we would expect to see more divergent haplotypes than we currently see. The very unusual highly ethnically-specific distribution of G2c in Europe combined with the very late tMRCA raises the question of from where G2c could have entered Europe. Also, was the spread of G2c in Europe from the Kingdom of Poland to Germany and Italy, from German to Italy and Poland, or Italy northward to both other areas? No one particular region seems to be more divergent than any other, and in fact, there doesn't seem to be any geographically correlated subclades within European G2c, with samples from each region matching some from other regions more closely than ones from the same region.

Possible history

Sicily

The most plausible scenario for the spread of G2c within Europe is an origin among Jews in Sicily, and a spread northward to Germany and the Polish-Lithuanian Commonwealth at the time of the expulsion of the Jews of Sicily in 1492.

It is estimated that Jews made up 6% or more of the population of Sicily in 1492.[24] Historical evidence shows that most Sicilian Jews went eastward to the Ottoman Empire, where Sicilian Jewish congregations existed in Salonika and Constantinople until the late 19th century. However, it is known that many Sicilian Jews first went to Calabria, and then Jews were expelled from Calabria in 1524, and later from the entire Kingdom of Naples in 1540. Thre was a gradual movement throughout the 16th century of Jews in Italy from south to north, with conditions worsening for Jews in Rome after 1556 and Venice in the 1580s. Many Jews from Venice and the surrounding area migrated to Poland and Lithuania at this time.[24][25][26][27]

In this scenario it may be that there was a direct migration from Sicily or Southern Italy separately to both Western Germany and Poland-Lithuania, but the presence of G2c in Germany may be due to a later migration from Eastern Europe to Germany starting with the aftermath of Khmelnytsky's Pogrom in Poland in 1648,

Jews had lived in Sicily since Roman times. After the Byzantine reconquest of Sicily from the Arian Ostrogoths who were very tolerant of the Jews in 552, conditions worsened dramatically for Jews in Sicily. Under the Byzantine Empire few Jews lived in Sicily because of official persecution. Before 606 the bishop of Palermo ordered the synagogue to be converted into a church. An edict issued by Leo III the Isaurian in 722 which ordered the baptism by force of all Jews in the Empire.[28] After the Muslim conquest of Sicily in 831-902, large numbers of Jews settled on the island.[29] In 972, the Arab merchant Ibn Hawqal mentioned a Jewish Quarter in Palermo, and by 1170, Benjamin of Tudela reported 1500 Jewish households in Palermo and 200 in Messina.[30] In 1149, Roger II forcibly brought the Jewish brocade, damask, and silk weavers of Thebes in Greece to Sicily to establish a silk industry there.[24][31][32] This is an example of a late entry into Sicily of non-Iberian, non-Provençal Jews from outside of Western and Central Europe, from a region that has been poorly tested or devoid of Jews in modern times.

The preliminary conclusions from this evidence is that haplogroup G2c is not native to Europe. The very late tMRCA, and the very high ethnic specificity indicate a rather brief presence in Europe, but one that participated in the exponential growth of the Ashkenazi Jewish population in Eastern and Central Europe after the Black Death. The complete lack of G2c in Iberia and also so far among Spanish Jews indicates that G2c didn't come from Spain, or France, since some Spanish Jewish families originated in southern France and migrated to Spain after France expelled the Jews in 1306. This, along with the other evidence, leaves Sicily as the European origin of G2c. We know that Greek and Mizrahi Jews arrived in Sicily as late as 1149,and that primarily most Sicilian Jews settled there during the Arab Emirate of Sicily. This is one way of explaining the very late presence of G2c in Europe, the likely presence of G2c among at least Kurdish Jews, if not other Mizrahi Jews as well.

The East - the Pathans and the Burushos

The presence of G2c in the these areas may be accounted for by several several separate theories, each with their own time scale. It does seem very likely that G2c originated in the Near East, in Anatolia or Syria, and spread both eastward and westward from there.

One often stated idea is of a direct Israelite ancestry for the Pashtuns as a whole. The Israelite origin of all the Pashtuns is contradicted by the ancient sources,[33][34] and also by the Iranian linguistic affiliations of the Pashto language. These stories were disseminated in Medieval times for religious reasons, and as part of the competition between the Mughals and the Pashtuns. However, this does not negate a possible Medieval Jewish origin for some of the Pashtun sub-tribes, but this would depend on the frequency of G2c among the Pashtuns, since any Jewish genetic admixture in relatively recent times would have been limited in scope.

The Silk Road

The rarity of G2c in northeast Pakistan could indicate that G2c in this area originates outside the region and was brought there in the historic period from further west (this area was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). These two reported G2c haplotypes seem to be quite divergent from both the Ashkenazi Jewish clade and the lone northeastern Anatolian G2c based on only 10 Y-STRs, and therefore may not indicate a recent common origin. Another possible route which brought G2c to this region is through trade, because Hunza is a fertile valley that was a major stopping point along the southern Silk Road just before the Khunjerab Pass into China.[35]

A Northern Near Eastern / South Caucasian origin for G2c is much more likely. The Turkish G2c haplotype, and 5 of 6 other almost certain G2c Armenian haplotypes have ancestors from a small region in Kars Province of Turkey near the Medieval capitals of Armenia. The rarity of G2c, which is limited to this small area which only became important after the year 884 is most likely due to G2c arriving in the region after this time.

Again, the Jewish areas of Kurdistan were not far from this same region. Haplogroup G has its greatest diversity in this same area, where all recorded sub-haplogroups of G have been found, so the evidence seems to point to this region of Eastern Anatolia or south of the Caucasus as the area of origin for all of haplogroup G as well. G2c could have spread from this region eastward toward the Hindu Kush and the Karakorum ranges, and southward among the Judeans, and then subsequently westward with the Jewish Diaspora to Italy and then Central and Eastern Europe. If the evidence shows that no Sephardi or Mizrahi Jews have G2c, then an origin with the Khazars of the Caucasus or another associated people who historically converted to Judaism during the Khazar Empire (c. 670-1017) is possible. However, the regions where G2c is found in northeastern Anatolia and Armenia were never part of the Khazar Empire, even at its greatest extent.

Further avenues for research

More samples from Italy are very important. Also, deriving a tMRCA for all of European G2c, including Italy is crucial. One would expect that the tMRCA including Italy would be a bit further back than circa 1492, but so far there is no evidence for this. Confirming whether there are other Jewish G2c's that are not European, and then getting the tMRCA with these samples will indicate the immediate source of Ashkenazi Jewish G2c. Confirmation that the Armenian haplotypes are actually G2c is also needed. Then, finding more G2c's in the Kashmir region and calculating a tMRCA, with the Turkish G2c sample and the Jewish G2c's, would indicate the direction of the gene flow.

Famous people in haplogroup G2c

Physicist and author.
Leading American film and television actor.
Former Chairman of the United States Federal Communications Commission (FCC) and Chairman of the Public Broadcasting Service (PBS).

See also

References

  1. ^ a b c d Sengupta S, Zhivotovsky LA, King R, et al. (2006). "Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of central asian pastoralists (Table 2)". Am. J. Hum. Genet. 78 (2): 202–21. doi:10.1086/499411. PMC 1380230. PMID 16400607. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1380230. 
  2. ^ M201 mutation
  3. ^ Haplogroup G SNP project
  4. ^ Behar DM, Garrigan D, Kaplan ME, et al. (2004). "Contrasting patterns of Y chromosome variation in Ashkenazi Jewish and host non-Jewish European populations (Table 2)". Hum. Genet. 114 (4): 354–65. doi:10.1007/s00439-003-1073-7. PMID 14740294. 
  5. ^ Deutsch, Gotthard (1906). "Austria - From the Expulsion of 1420 to that of 1670". Jewish Encyclopedia. http://www.jewishencyclopedia.com/view.jsp?artid=2152&letter=A&search=Austria#6712. Retrieved 2007-09-16. 
  6. ^ Underhill, Peter (2007-09-24). "Personal communication from the primary author". 
  7. ^ Cinnioğlu C, King R, Kivisild T, Kalfoglu E, Atasoy S, Cavalleri GL, Lillie AS, Roseman CC, Lin AA, Prince K, Oefner PJ, Shen P, Semino O, Cavalli-Sforza LL, Underhill PA. (2004). "Excavating Y-chromosome haplotype strata in Anatolia.". Hum. Genet. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639. 
  8. ^ a b c Firasat S, Khaliq S, Mohyuddin A, et al. (2007). "Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan". Eur. J. Hum. Genet. 15 (1): 121–6. doi:10.1038/sj.ejhg.5201726. PMC 2588664. PMID 17047675. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2588664. 
  9. ^ "YHRD.org: Result for haplotype 16-13-30-23-11-11-13--1--1--1". http://www.yhrd.org/rcms/navigation/1000081.html?dys19=16&dys389i=13&dys389ii=30&dys390=23&dys391=11&dys392=11&dys393=13&dys385=-1&dys438=-1&dys439=-1&release=*&geogroup=*. 
  10. ^ "YHRD.org: Result for haplotype 17-13-30-23-11-11-13--1--1--1". http://www.yhrd.org/rcms/navigation/1000081.html?dys19=17&dys389i=13&dys389ii=30&dys390=23&dys391=11&dys392=11&dys393=13&dys385=-1&dys438=-1&dys439=-1&release=*&geogroup=*. 
  11. ^ Hovannisian, Richard G. (1997). The Armenian people from ancient to modern times: from antiquity to the fourteenth century. Palgrave Macmillan. pp. 136. ISBN 0-312-10168-6. 
  12. ^ Kurkjian, Vahan (1958). History of Armenia. Armenian General Benevolent Union of America. pp. Chapter XXIV The Bagratid Dynasty - The Bagratuni pg. 186 ff.. http://penelope.uchicago.edu/Thayer/E/Gazetteer/Places/Asia/Armenia/_Texts/KURARM/24*.html#p186. 
  13. ^ Hewsen, Robert H. (2001). Armenia: A Historical Atlas. Chicago, Illinois: The University of Chicago Press. pp. Map 91. The Bagratid Kingdoms in Armenia, 962–1064. ISBN 978-0-226-33228-4. http://www.press.uchicago.edu/Images/Chicago/hewsen91.html. 
  14. ^ "VitrualANI - The City of Ani: A very brief history". http://www.virtualani.org/history/part1.htm. Retrieved 2007-10-02. 
  15. ^ of Rubruck, William (c. 1255). Itinerarium fratris Willielmi de Rubruquis de ordine fratrum Minorum, Galli, Anno gratia 1253 ad partes Orientales.. pp. Chapter XXXVIII. http://www.virtualani.org/accounts/william_of_rubruck.htm. 
  16. ^ Alexanian, Moorad (2000-06-16). "ASA - June 2000: Jewish History of Armenia". http://www.asa3.org/archive/asa/200006/0127.html. Retrieved 2007-10-02. 
  17. ^ Rosenthal, Herman; J.G. Lipman (1906-05-01). "Kurdistan". In Isidore Singer, Ph.D.. Jewish Encyclopedia (1st ed.). New York, New York: Funk & Wagnall. pp. 585–586. http://www.jewishencyclopedia.com/view.jsp?artid=454&letter=K. Retrieved 2007-10-20. 
  18. ^ Y Chromosome Consortium (2002). "YCC NRY Tree 2002 v2002.01.18". http://ycc.biosci.arizona.edu/nomenclature_system/fig1.html. Retrieved 2007-09-16. 
  19. ^ Nebel A, Filon D, Brinkmann B, Majumder PP, Faerman M, Oppenheim A (2001). "The Y chromosome pool of Jews as part of the genetic landscape of the Middle East (Appendix Table A1)". Am. J. Hum. Genet. 69 (5): 1095–112. doi:10.1086/324070. PMC 1274378. PMID 11573163. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1274378. 
  20. ^ "ySearch haplotypes in G2 and I which match G2c at 6 STRs". http://www.ysearch.org/research_comparative.asp?uid=&vallist=7BGXR%2C+BR6B6%2C+SJBZS%2C+ZBN3A%2C+WZCTN%2C+6HHBS%2C+SHBA2%2C+6Z4CT%2C+6JJSC%2C+94DP6%2C+XGE9E%2C+KC2C3%2C+98VNY%2C+3ZREM%2C+45X9R%2C+35VRW%2C+BAZBP%2C+MSJSY%2C+M5YRG%2C+8CCMV%2C+58X66%2C+CWN93. Retrieved 2007-10-08. 
  21. ^ Bandelt HJ, Forster P, Röhl A (1999). "Median-joining networks for inferring intraspecific phylogenies". Mol. Biol. Evol. 16 (1): 37–48. PMID 10331250. 
  22. ^ Kandell, Ted. "G2c tMRCA estimate (fast mutation STRs = 5) @ 81 years per rho = 1489". http://www.archaeogenetics.org/y-dna/G/G2c/G2c%20tMRCA%20estimate%20fast%20mutating%20=%205%20@%2081%20years%20per%20rho%20=%201489.jpg. Retrieved 2007-10-03. 
  23. ^ Kandell, Ted (2007-09-29). "G2c Athey family median-joining network tMRCA estimate (fast mutating STRs = 5) @ 81 years per rho = 1641 (average birth year = 1947, known MRCA b. 1643)". http://www.archaeogenetics.org/y-dna/G/G2%20Athey%20tMRCA%20estimate%20fast%20mutating%20=%205%20@%2081%20years%20per%20rho%20=%201641.jpg. Retrieved 2007-10-03. 
  24. ^ a b c Talalay Dardashti, Schelly (2006-08-20). "Tracing the Tribe: At the ICJG: Jews in Italy". http://tracingthetribe.blogspot.com/2006/08/at-icjg-jews-in-italy.html. Retrieved 2007-09-19. 
  25. ^ Singer, Isidore (1906). "Rapoport". Jewish Encyclopedia. http://www.jewishencyclopedia.com/view.jsp?artid=112&letter=R. Retrieved 2007-09-16. 
  26. ^ Kayserling, Meyer; Gotthard Deutsch, M. Seligsohn, Peter Wiernik, N.T. London, Solomon Schechter, Henry Malter, Herman Rosenthal, Joseph Jacobs (1906). "Katzenellenbogen". Jewish Encyclopedia. http://www.jewishencyclopedia.com/view.jsp?artid=135&letter=K#403. Retrieved 2007-09-16. 
  27. ^ Colletta, John Phillip (2003). Finding Italian Roots: The Complete Guide for Americans. Genealogical Publishing. pp. 146–148. ISBN 0806317418. http://books.google.com/?id=HAuKMViN-OgC&pg=PA148&lpg=PA148. 
  28. ^ Neil, Bronwen (2000=11-25). "Roman Emperors - DIR Leo II". http://www.roman-emperors.org/leoiii.htm. Retrieved 2007-09-23. 
  29. ^ Cracco Ruggini, Lellia (1984). "Christianization in Sicily (IIIrd - VIIth Century)" (PDF). Gerión: 226. http://www.ucm.es/BUCM/revistas/ghi/02130181/articulos/GERI8383110219A.PDF. Retrieved 2007-09-23. 
  30. ^ Dieli, Art (2005-12-13). "Italia Judaica". http://www.dieli.net/SicilyPage/JewishSicily/ItaliaJudaica.html. Retrieved 2007-09-23. 
  31. ^ Martino, Giuseppe (2005-10-11). "The Jews of Messina" (in Italian with English translation). http://www.dieli.net/SicilyPage/JewishSicily/JudaicaMessina1.html. Retrieved 2007-09-19. 
  32. ^ Dieli, Art (2005-11-29). "Jewish Names in Sicily". http://www.dieli.net/SicilyPage/JewishSicily/JewishNames.html. Retrieved 2007-09-19. 
  33. ^ Rig Veda. pp. e.g. in 4.25.7c. 
  34. ^ Herodotus. Histories. pp. Book IV v.44 and Book III v.91. 
  35. ^ Shirazi, S.A.J. (2006-07-11). "Guest Post: Adventures up the Silk Road: All Things Pakistan". http://pakistaniat.com/2006/07/11/guest-post-adventures-up-the-silk-road/. Retrieved 2007-09-23. 

External links

Sites

Maps

Mailing Lists

Evolutionary tree of Human Y-chromosome DNA (Y-DNA) haplogroups

most recent common Y-ancestor
A
A1b A1a-T
A1a A2-T
A2 A3 BT
B CT
DE CF
D E C F
G H IJK
IJ K
I J LT K(xLT)
L T M NO P S
O N Q R

Y-DNA by populations · Famous Y-DNA haplotypes